Prenatal Form and Function – The Making of an Earth Suit
Appendix
Appendix A − Calculations
DNA Replication Rates
Given:
- DNA contains 3 × 109 base pairs or 6 × 109 bases distributed within an equal number of nucleotides.
- Mitosis occurs every 8 hours.
- DNA replication must be completed prior to cell division.
Step 1 - Computing the replication rate
1 minute/60 seconds = 208,333 nucleotides replicated/second
To the Sun and Back - Computing the Length of DNA in an Adult
- The DNA molecule measures 3.4 × 10-9 meters per 10 base pairs1
- There are 3 billion base pairs /cell.
- There are an estimated 100 trillion cells per adult.
- The distance from the earth to the sun is approximately 93 million miles.
- There are 2.54 inches per centimeter (cm).
Step 1 - Compute Length of DNA in a single cell
Step 2 - Compute total length of DNA in an adult
Step 3 - Convert 1.02 x 1014 meters to miles
Step 4 - Compute how many round trips from the earth to the sun
the earth to sun and back
Therefore, the DNA in a single adult, if oriented in linear fashion would exceed 63 billion miles in length. This is long enough to extend from the earth to the sun and back - 340 times
* Approximately 25 trillion red blood cells are present in the adult.2 It should be noted that red blood cells contain DNA during their maturation phase but this DNA degenerates and is not present in the mature form. This calculation includes the DNA from red blood cells.
A Tight Squeeze: Appreciating the Number of Bases Contained in the DNA of a Single Cell
The following page contains a list of 3,808 capital letters each of which represents a single base.
Given:
- A, G, T, and C each represent a base within the DNA of a single cell
- Each line contains 68 letters without spaces representing 68 bases.
- Each page contains 56 lines. (Page size: 8½ × 11 inches, font size: 10, spaces between letters: none, lines: single spaced, margins: standard)
- Each cell contains 3 billion base pairs equaling 6 billion bases.
The calculation of the number of pages required to list all DNA bases in a single cell is as follows:
6,000,000,000 bases/cell ÷ 3,808 bases/page = 1,575,630 pages/cell
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
Climate Control: Approximating the Normal Range of Embryonic and Fetal Body Temperature
Given:
- The placenta maintains fetal temperature between 0.5 ºC and 1.5 ºC above maternal core temperature.3
- Maternal core temperature is 99.6º Fahrenheit
- The formula to convert temperature from Fahrenheit (ºF) to Celsius (ºC) is ºC = 5/9 (ºF - 32)
The calculation to compute the range of embryonic/fetal body temperature is as follows:
Step 1 - Convert maternal core temperature from Fahrenheit to Celsius
Maternal core temperature in ºC = 5/9 (99.6 - 32) = 37.56 ºC
Step 2 - Compute lower and upper ranges of fetal body temperature in Celsius
Upper Range (Celsius) = maternal core temperature + 1.5 ºC = 37.56 + 1.5 = 39.2 ºC
Step 3 - Convert Results to Fahrenheit
Substituting to Find the Lower Limit of Fetal Body Temperature
ºF = 9/5 ºC + 32 ºF = 9/5 (38.16) + 32 ºF = 100.7º
Substituting to Find the Upper Limit of Fetal Body Temperature
ºF = 9/5 ºC + 32 ºF = 9/5 (39.16) + 32 ºF = 102.5º
Summary of Normal Fetal Body Temperature Range
°F | °C | |
---|---|---|
Upper Limit | 100.7 | 38.2 |
Lower Limit | 102.5 | 39.2 |
The Beat Goes On – Tracking the Total Number of Heart Beats During Pregnancy and Beyond
Estimating the Number of Heart Beats Before Birtha
Week # | Average Heart Rate (Beats per Minute) |
Beats per Week | Running Total |
---|---|---|---|
4 | 113.00 | 1,139,040 | 1,139,040 |
5 | 132.00 | 1,330,560 | 2,469,600 |
6 | 151.00 | 1,522,080 | 3,991,680 |
7 | 170.00 | 1,713,600 | 5,705,280 |
8 | 169.03 | 1,703,845 | 7,409,125 |
(Approximately 7.41 million beats during the embryonic period) |
Various authors agree the heart rate peaks at 7 weeks. Reported heart rates vary however. Van Heeswijk et al. report a peak heart rate of 167 ± 8 beats per minute (bpm)4 while Leeuwen et al. report a peak rate of 175 bpm.5 Van Lith et al. report the median fetal heart rate peaks at 177 bpm at 7 weeks.6 One hundred seventy (170) bpm has been chosen as the peak heart rate for illustration purposes in this calculation. The heart rate for the various weeks from 7 through 38 have been calculated via linear interpolations7 assuming heart rates of 170 bpm at 7 weeks and 140 bpm at term or 38 weeks.8
(Note: Heart rates are estimated. Living conditions and individual experience can and will vary.)
Fetal Period
Week # | Average Heart Rate (Beats per Minute) |
Beats per Week | Running Total |
---|---|---|---|
9 | 168.06 | 1,694,090 | 9,103,216 |
10 | 167.10 | 1,684,336 | 10,787,551 |
11 | 166.13 | 1,674,581 | 12,462,132 |
12 | 165.16 | 1,664,826 | 14,126,958 |
13 | 164.19 | 1,655,071 | 15,782,029 |
14 | 163.23 | 1,645,316 | 17,427,346 |
15 | 162.26 | 1,635,562 | 19,062,907 |
16 | 161.29 | 1,625,807 | 20,688,714 |
17 | 160.32 | 1,616,052 | 22,304,766 |
18 | 159.35 | 1,606,297 | 23,911,063 |
19 | 158.39 | 1,596,542 | 25,507,605 |
20 | 157.42 | 1,586,787 | 27,094,393 |
21 | 156.45 | 1,577,033 | 28,671,425 |
22 | 155.48 | 1,567,278 | 30,238,703 |
23 | 154.52 | 1,557,523 | 31,796,226 |
24 | 153.55 | 1,547,768 | 33,343,994 |
25 | 152.58 | 1,538,013 | 34,882,008 |
26 | 151.61 | 1,528,259 | 36,410,266 |
27 | 150.65 | 1,518,504 | 37,928,770 |
28 | 149.68 | 1,508,749 | 39,437,519 |
29 | 148.71 | 1,498,994 | 40,936,513 |
30 | 147.74 | 1,489,239 | 42,425,752 |
31 | 146.77 | 1,479,484 | 43,905,237 |
32 | 145.81 | 1,469,730 | 45,374,966 |
33 | 144.84 | 1,459,975 | 46,834,941 |
34 | 143.87 | 1,450,220 | 48,285,161 |
35 | 142.90 | 1,440,465 | 49,725,626 |
36 | 141.94 | 1,430,710 | 51,156,337 |
37 | 140.97 | 1,420,956 | 52,577,292 |
38 | 140.00 | 1,411,201 | 53,988,493 |
(Approximately 54 million beats before birth) |
Counting the Beats of Life
The Postnatal Period from Birth to 80 Years
Year # | Average Heart Rate (Beats per Minute)9 |
Beats per Year | Running Total |
---|---|---|---|
1 | 120 | 63,115,200 | 63,115,200 |
2 | 110 | 57,855,600 | 120,970,800 |
3 | 103 | 54,173,880 | 175,144,680 |
4 | 103 | 54,173,880 | 229,318,560 |
5 | 103 | 54,173,880 | 283,492,440 |
6 | 103 | 54,173,880 | 337,666,320 |
7 | 95 | 49,966,200 | 387,632,520 |
8 | 95 | 49,966,200 | 437,598,720 |
9 | 95 | 49,966,200 | 487,564,920 |
10 | 95 | 49,966,200 | 537,531,120 |
11 | 85 | 44,706,600 | 582,237,720 |
12 | 85 | 44,706,600 | 626,944,320 |
13 | 85 | 44,706,600 | 671,650,920 |
14 | 85 | 44,706,600 | 716,357,520 |
15 | 80 | 42,076,800 | 758,434,320 |
16 | 80 | 42,076,800 | 800,511,120 |
17 | 75 | 39,447,000 | 839,958,120 |
18 | 75 | 39,447,000 | 879,405,120 |
19 | 70 | 36,817,200 | 916,222,320 |
20 | 70 | 36,817,200 | 953,039,520 |
21-80 | 70 | 2,209,032,000 | 3,162,071,520 |
(Approximately 3.16 billion beats from birth to age 80 years) | |||
Estimated Total Heart Beats From the 3-Week Embryo to Age 80 Years |
3,216,060,000 | ||
(Approximately 3.2 Billion Beats Per Lifetime) |
Appendix B − Relating Embryonic Age & Stage
O'Rahilly and Müller's Age Assignments vs. Carnegie Stages, 1987 to 2001
Carnegie Stage |
Number of Somites |
Greatest Length (mm) |
1987 Age 10 Convention (in PF Days*) |
1999 Age 11 Convention (in PF Days*) |
2001 Age 12 Convention (in PF Days*) |
---|---|---|---|---|---|
1 | 0.1 - 0.15 | 1 | - | 1 | |
2 | 0.1 - 0.2 | 1½ - 3 | 2 - 3 | 2 - 3 | |
3 | 0.1 - 0.2 | 4 | 4 - 5 | 4 - 5 | |
4 | 0.1 - 0.2 | 5 - 6 | 6 | 6 | |
5 | 0.1 - 0.2 | 7 - 12 | 7 - 12 | - | |
5a | 0.1 | 7 - 8 | - | 7 - 8 | |
5b | 0.1 | 9 | - | 9 | |
5c | 0.15 - 0.2 | 11 - 12 | - | 11 - 12 | |
6 | 0.2 | 13 | 17 | 17 | |
6a | - | - | - | - | |
6b | - | - | - | - | |
7 | 0.4 | 16 | 19 | 19 | |
8 | 1.0 - 1.5 | 18 | 23 | - | |
8a | - | - | - | 23 | |
8b | - | - | - | 23 | |
9 | 1-3 | 1.5 - 2.5 | 20 | 26 | 25 |
10 | 4-12 | 2 - 3.5 | 22 | 29 | 28 |
11 | 13-20 | 2.5 - 4.5 | 24 | 30 | 29 |
12 | 21-29 | 3 - 5 | 26 | 31 | 30 |
13 | 30+ | 4 - 6 | 28 | 32 | 32 |
14 | 5 - 7 | 32 | 33 | 33 | |
15 | 7 - 9 | 33 | 35 | 36 | |
16 | 8 - 11 | 37 | 37 | 38 | |
17 | 11 - 14 | 41 | 40 | 41 | |
18 | 13 - 17 | 44 | 42 | 44 | |
19 | 16 - 18 | 47½ | 44 | 46 | |
20 | 18 - 22 | 50½ | 47 | 49 | |
21 | 22 - 24 | 52 | 50 | 51 | |
22 | 23 - 28 | 54 | 52 | 53 | |
23 | 27 - 31 | 56½ | 56 | 56 |
* PF Days = Postfertilization Days
There is international agreement among embryologists that human development during the embryonic period be divided into 23 stages which were initially proposed by Mall, described by Streeter, and amended by O'Rahilly and Müller in 1987.13 These have come to be known as Carnegie Stages. Particular internal and external features are required for inclusion in any given embryonic stage. These stages are independent of age and length and the use of the term 'stage' should be reserved for reference to this system per O'Rahilly and Müller in multiple publications.
Along with nearly-universal acceptance of the human embryonic staging system, a variety of age assignments have been proposed for each embryonic stage. Streeter believed the embryonic period spanned a 47- to 48- day period instead of the 56-day period accepted today. The Endowment for Human Development adopts the convention set forth by O'Rahilly and Müller in 1987 which has received widespread, but not universal, acceptance. O'Rahilly and Müller have since proposed amending this convention in light of transvaginal ultrasound data through a personal communication with Dr. Josef Wisser in 1992.14 These alternate proposals are provided for the interested reader.
For instance, the onset of embryonic cardiac contraction (onset of the heartbeat) has long been described as a Carnegie Stage 10 or possibly a late Stage 9 event.15 We report this event occurring at an age of 3 weeks, 1 day (22 days) postfertilization using the 1987 convention. Others may report this occurrence at 28 or 29 days as shown above. Of interest is a paper by Wisser and Dirschedl who reported using transvaginal ultrasound to visualize the embryonic heartbeat 23 days postfertilization in two embryos fertilized in vitro "with exactly known … age" and "in embryos from 2 mm of greatest length onwards."16 This finding most closely coincides with the 1987 age convention. Schats et al. reported the earliest cardiac activity at 25 days after follicle aspiration in embryos conceived in vitro.17 Tezuka et al. reported the earliest cardiac activity at 23 days postfertilization in embryos conceived naturally.18
There is considerable variation in normal human development during the postnatal period. The prenatal period is no different with variations in the size, rate of growth, and order of appearance of some structures or functions. No one knows the exact age range for each stage with absolute certainty. These approximations may change in the future as additional knowledge is gained through careful, published research.
Footnotes1 | Lodish et al., 2000. 104. |
2 | Guyton and Hall, 2000. 2. |
3 | Liley, 1972. 101. |
4 | van Heeswijk et al., 1990. 153. |
5 | Leeuwen et al., 1999. 265. |
6 | van Lith et al., 1992. 741. |
7 | See Appendix A. |
8 | DiPietro et al., 1996. 2559. |
9 | Bates, 1987. 541. |
10 | O'Rahilly and Müller, 1987. 3. |
11 | O'Rahilly and Müller, 1999a. Various pages. |
12 | O'Rahilly and Müller, 2001. 490. |
13 | O'Rahilly and Müller, 2001. 3. |
14 | O'Rahilly and Müller, 1999a. 13. |
15 | Campbell, 2004. 14; Carlson, 2004. 430; de Vries and Saunders, 1962. 96; Gardner and O'Rahilly, 1976. 583; Gilbert-Barness and Debich-Spicer, 1997. 650; Gittenger-de Groot et al., 2000. 17; van Heeswijk et al., 1990. 151; Kurjak and Kos, 1994. 439; Navaratnam, 1991. 147-148; O'Rahilly and Müller, 1987. 99; Wisser and Dirschedl, 1994. 108. |
16 | Wisser and Dirschedl, 1994. 108. |
17 | Schats et al., 1990. 989. |
18 | Tezuka et al., 1991. 211. The earliest cardiac activity reported occurred at 37 postmenstrual days or 23 postfertilization days. |